BItsliced Genomic Signature Index [bigsi]

BItsliced Genomic Signature Index [BIGSI] Docs

Welcome to the BIGSI documentation. You'll find comprehensive guides and documentation to help you start working with BIGSI as quickly as possible.

BIGSIs–BItsliced Genomic Signature Indexes–allow for efficient indexing and search in very large collections of WGS data, in particular bacterial or viral data sets WGS data sets. BIGSI can index and query raw, or assembled data.

A prebuilt index is available for download at http://ftp.ebi.ac.uk/pub/software/bigsi/nat_biotech_2018/all-microbial-index-v03/ or a hosted demo is available here http://www.bigsi.io/.

Please cite our paper if you use this tool in your research:
'Ultra-fast search of all deposited bacterial and viral genomic data' http://dx.doi.org/10.1038/s41587-018-0010-1

Get Started    Guides

API queries

An experimental API is hosted by MRC CLIMB at http://api.bigsi.io.

See some examples of queries for MCR-1.

cURL

curl "http://api.bigsi.io/search?seq=CGGTCAGTCCGTTTGTTCTTGTGGCGAGTGTTGCCGTTTTCTTGACCGCGACCGCCAATCTTACCTTTTTTGATAAAATCAGCCAAACCTATCCCATCGCGGACAATCTCGGCTTTGTGCTGACGATCGCTGTCGTGCTCTTTGGCGCGATGCTACTGATCACCACGCTGTTATCATCGTATCGCTATGTGCTAAAGCCTGTGTTGATTTTGCTATTAATCATGGGCGCGGTGACCAGTTATTTTACTGACACTTATGGCACGGTCTATGATACGACCATGCTCCAAAATGCCCTACAGACCGACCAAGCCGAGACCAAGGATCTATTAAACGCAGCGTTTATCATGCGTATCATTGGTTTGGGTGTGCTACCAAGTTTGCTTGTGGCTTTTGTTAAGGTGGATTATCCGACTTGGGGCAAGGGTTTGATGCGCCGATTGGGCTTGATCGTGGCAAGTCTTGCGCTGATTTTACTGCCTGTGGTGGCGTTCAGCAGTCATTATGCCAGTTTCTTTCGCGTGCATAAGCCGCTGCGTAGCTATGTCAATCCGATCATGCCAATCTACTCGGTGGGTAAGCTTGCCAGTATTGAGTATAAAAAAGCCAGTGCGCCAAAAGATACCATTTATCACGCCAAAGACGCGGTACAAGCAACCAAGCCTGATATGCGTAAGCCACGCCTAGTGGTGTTCGTCGTCGGTGAGACGGCACGCGCCGATCATGTCAGCTTCAATGGCTATGAGCGCGATACTTTCCCACAGCTTGCCAAGATCGATGGCGTGACCAATTTTAGCAATGTCACATCGTGCGGCACATCGACGGCGTATTCTGTGCCGTGTATGTTCAGCTATCTGGGCGCGGATGAGTATGATGTCGATACCGCCAAATACCAAGAAAATGTGCTGGATACGCTGGATCGCTTGGGCGTAAGTATCTTGTGGCGTGATAATAATTCGGACTCAAAAGGCGTGATGGATAAGCTGCCAAAAGCGCAATTTGCCGATTATAAATCCGCGACCAACAACGCCATCTGCAACACCAATCCTTATAACGAATGCCGCGATGTCGGTATGCTCGTTGGCTTAGATGACTTTGTCGCTGCCAATAACGGCAAAGATATGCTGATCATGCTGCACCAAATGGGCAATCACGGGCCTGCGTATTTTAAGCGATATGATGAAAAGTTTGCCAAATTCACGCCAGTGTGTGAAGGTAATGAGCTTGCCAAGTGCGAACATCAGTCCTTGATCAATGCTTATGACAATGCCTTGCTTGCCACCGATGATTTCATCGCTCAAAGTATCCAGTGGCTGCAGACGCACAGCAATGCCTATGATGTCTCAATGCTGTATGTCAGCGATCATGGCGAAAGTCTGGGTGAGAACGGTGTCTATCTACATGGTATGCCAAATGCCTTTGCACCAAAAGAACAGCGCAGTGTGCCTGCATTTTTCTGGACGGATAAGCAAACTGGCATCACGCCAATGGCAACCGATACCGTCCTGACC&threshold=1"

Python

import requests
import begin


def search(seq, threshold=1):
    url = "http://api.bigsi.io/search?threshold=%f&seq=%s" % (
        float(threshold), seq)
    results = requests.get(url).json()
    samples = []
    for i, j in list(results.values())[0]["results"].items():
        samples.append(i)
    return samples


@begin.start
def main(seq, threshold=1):
    samples = search(seq, threshold)
    for s in samples:
      print(s)

R

#install.packages('jsonlite')
#install.packages('curl')
library(jsonlite)
seq<-"CGGTCAGTCCGTTTGTTCTTGTGGCGAGTGTTGCCGTTTTCTTGACCGCGACCGCCAATCTTACCTTTTTTGATAAAATCAGCCAAACCTATCCCATCGCGGACAATCTCGGCTTTGTGCTGACGATCGCTGTCGTGCTCTTTGGCGCGATGCTACTGATCACCACGCTGTTATCATCGTATCGCTATGTGCTAAAGCCTGTGTTGATTTTGCTATTAATCATGGGCGCGGTGACCAGTTATTTTACTGACACTTATGGCACGGTCTATGATACGACCATGCTCCAAAATGCCCTACAGACCGACCAAGCCGAGACCAAGGATCTATTAAACGCAGCGTTTATCATGCGTATCATTGGTTTGGGTGTGCTACCAAGTTTGCTTGTGGCTTTTGTTAAGGTGGATTATCCGACTTGGGGCAAGGGTTTGATGCGCCGATTGGGCTTGATCGTGGCAAGTCTTGCGCTGATTTTACTGCCTGTGGTGGCGTTCAGCAGTCATTATGCCAGTTTCTTTCGCGTGCATAAGCCGCTGCGTAGCTATGTCAATCCGATCATGCCAATCTACTCGGTGGGTAAGCTTGCCAGTATTGAGTATAAAAAAGCCAGTGCGCCAAAAGATACCATTTATCACGCCAAAGACGCGGTACAAGCAACCAAGCCTGATATGCGTAAGCCACGCCTAGTGGTGTTCGTCGTCGGTGAGACGGCACGCGCCGATCATGTCAGCTTCAATGGCTATGAGCGCGATACTTTCCCACAGCTTGCCAAGATCGATGGCGTGACCAATTTTAGCAATGTCACATCGTGCGGCACATCGACGGCGTATTCTGTGCCGTGTATGTTCAGCTATCTGGGCGCGGATGAGTATGATGTCGATACCGCCAAATACCAAGAAAATGTGCTGGATACGCTGGATCGCTTGGGCGTAAGTATCTTGTGGCGTGATAATAATTCGGACTCAAAAGGCGTGATGGATAAGCTGCCAAAAGCGCAATTTGCCGATTATAAATCCGCGACCAACAACGCCATCTGCAACACCAATCCTTATAACGAATGCCGCGATGTCGGTATGCTCGTTGGCTTAGATGACTTTGTCGCTGCCAATAACGGCAAAGATATGCTGATCATGCTGCACCAAATGGGCAATCACGGGCCTGCGTATTTTAAGCGATATGATGAAAAGTTTGCCAAATTCACGCCAGTGTGTGAAGGTAATGAGCTTGCCAAGTGCGAACATCAGTCCTTGATCAATGCTTATGACAATGCCTTGCTTGCCACCGATGATTTCATCGCTCAAAGTATCCAGTGGCTGCAGACGCACAGCAATGCCTATGATGTCTCAATGCTGTATGTCAGCGATCATGGCGAAAGTCTGGGTGAGAACGGTGTCTATCTACATGGTATGCCAAATGCCTTTGCACCAAAAGAACAGCGCAGTGTGCCTGCATTTTTCTGGACGGATAAGCAAACTGGCATCACGCCAATGGCAACCGATACCGTCCTGACC"

search <- function(seq, threshold=1){
  url=paste("http://api.bigsi.io/search?threshold=",str(threshold),"&seq=", seq, sep="")
  result <- fromJSON(url)
  return (names(result[[seq]][["results"]]))
}
search(seq)

API queries


Suggested Edits are limited on API Reference Pages

You can only suggest edits to Markdown body content, but not to the API spec.